Reduction of Cytosolic p27 Inhibits Cancer Cell Motility, Survival, and Tumorigenicity

We generated a p27 mutant (p27#NLS) that localized exclusively in cell cytosol. Expression of p27#NLS in MCF7 breast cancer cells down-regulated RhoA and increased motility, survival, and Akt levels without an effect on cell cycle distribution. RNA interference of p27 in U87 glioma cells, which express p27 predominantly in the cytoplasm, inhibited motility and survival. Conversely, knockdown of p27 in COS7 cells, with >95% nuclear p27 expression, accelerated proliferation but had no effect on motility or survival. U87 cells in which p27 had been eliminated by RNA interference exhibited lower Akt levels, shorter Akt turnover, and markedly impaired tumorigenicity in vivo. These xenografts were less invasive and exhibited increased apoptosis compared with p27-expressing tumors. Expression of cytosolic p27 in primary human breast carcinomas correlated linearly with Akt content as measured by immunohistochemistry. These data suggest that cytoplasmic p27 can exert oncogenic functions by modulating Akt stability, cell survival, and tumorigenicity. (Cancer Res 2006; 66(4): 2162-72) Introduction p27 is a member of the Kip family of cyclin-dependent kinase (Cdk) inhibitors initially discovered as having a Cdk-inhibitory activity induced by extracellular antimitogenic signals (1, 2). It accumulates in serum-starved and density-arrested cells and its overexpresssion results in cell cycle arrest in G1 and/or apoptosis. Consistent with its role as a tumor suppressor, p27-null mice develop multiorgan hyperplasia and increased susceptibility to cancer (3). Loss of a single allele of p27 confers increased susceptibility to carcinogen-induced tumors in mice (4) and low levels of p27 protein have been associated with poor prognosis in several human cancers (5, 6). Inactivation of the cell cycle inhibitory activity of p27 is commonly observed in several cancers by mechanisms that mainly involve accelerated proteolysis, sequestration by cyclin D-Cdk complexes, and posttranslational modifications leading to nuclear export and/or retention in the cytosol (7). Cytoplasmic translocation of p27 has been increasingly recognized in primary human tumors associated with poor survival whereas nuclear expression confers a more favorable outcome (5, 6). The oncogenic kinase Akt and the growth factor–dependent human kinase-interacting stathmin have been causally associated with cytoplasmic retention and nuclear export of p27 (8–11), respectively, further implying a link between mislocalized p27 and enhanced transformation. A simple explanation as to how the cytoplasmic redistribution of p27 may contribute to transformation is derepression and activation of nuclear Cdk2. Interestingly, p27 does not fit Knudson’s ‘‘two-hit’’ criterion for most tumor suppressor genes in that inactivating mutations or homozygous deletions of both p27 alleles are exceedingly rare (3). This suggests lack of a selective pressure to lose p27 completely perhaps as the result of ‘‘gain-of-function’’ effects of low levels of mislocalized p27. Several mechanistic data suggest that cytosolic p27 has functions opposite to its tumor suppressor role. In the cytosol, p27 assembles cyclin D/Cdk4 complexes and promotes their import into the nucleus (12, 13). Transduction of TAT-p27 fusion protein into HepG2 hepatocellular cancer cells results in enhanced cell migration (14). Treatment with hepatocyte growth factor induces Ser phosphorylation-dependent nuclear export of p27. Once in the cytoplasm, p27 stimulates Rac-dependent migration of HepG2 cells and embryonic fibroblasts (15). In this study, a region in the COOH-terminal domain of p27, independent of its Cdk-inhibitory activity, was required for growth factor–stimulated migration. In a more recent report, Besson et al. (16) showed that p27 regulates cell migration by titrating the function of the RhoA GTPase as a result of direct binding to RhoA and inhibition of activation by its guanine nucleotide exchange factors. Thus, by decreasing actin stress fiber formation and adhesion, p27 alters the balance between RhoA and Rac and thus allows cell movement. Taken together, these data suggest that p27 may act as a tumor suppressor or as an oncogene depending on its subcellular localization. Therefore, to study gain-of-function effects of cytoplasmic p27 on transformation, we engineered a p27 mutant that exclusively localized in the cytosol. Expression of this mutant in MCF7 cells increased cell motility and survival while up-regulating Akt protein stability. To extend these observations, we hypothesized that elimination of p27 by RNA interference would have opposite effects in cells with predominant nuclear versus cytosolic localization. Knockdown of p27 in PTEN-null U87 tumor cells with predominant cytosolic p27 resulted in reduced cell motility, enhanced apoptosis, and lower levels and stability of Akt in vitro , as well as reduced tumorigenicity, tumor cell viability, and invasiveness in vivo . However, in COS7 cells with >95% nuclear p27, RNA interference of p27 only accelerated cell cycle progression without affecting cell survival or motility. These data support the oncogenic role of cytoplasmic mislocalized p27 and its potential use as a therapeutic target. The results also suggest that this approach would have opposite consequences depending as to where in the tumor cell p27 is predominantly localized. Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/). F.Y. Wu and S.E. Wang contributed equally to this work. Requests for reprints: Carlos L. Arteaga, Division of Oncology, Vanderbilt University Medical Center, 2220 Pierce Avenue, 777 PRB, Nashville, TN 37232-6307. Phone: 615-936-3524; Fax: 615-936-1790; E-mail: [email protected]. I2006 American Association for Cancer Research. doi:10.1158/0008-5472.CAN-05-3304 Cancer Res 2006; 66: (4). February 15, 2006 2162 www.aacrjournals.org Research Article Research. on April 20, 2017. © 2006 American Association for Cancer cancerres.aacrjournals.org Downloaded from Materials and Methods Cell lines, plasmids, and retroviruses. All cell lines were from the American Type Culture Collection (Rockville, MD). MCF-7, human embryo kidney cells 293T, African green monkey fibroblast kidney cells COS7, Phoenix-Ampho cells, and U87-MG glioma cells were grown in DMEM (Cambrex, Walkersville, MD) containing 10% fetal bovine serum (FBS; Hyclone, Logan, UT) in a humidified 5% CO2 incubator at 37jC. The p27 ( / ) mouse embryonic fibroblasts were generated as described previously (17) and were maintained in DMEM/10% FBS. To generate a p27 mutant with aspartic acid substitutions at Ser and Thr (referred herein as Flag-p27DD), we used the pcDNA 5VFlag-p27 plasmid (11) as the parent vector and the Stratagene QuickChange Multi Site-Directed Mutagenesis kit with two primers, namely (a) Ser mutant-F: 5V-phospho-GAGTGTCTAACGGGGACCCTAGCCTGGAGC-3Vand (b) Thr mutant-F: 5V-phospho-AATAAGGAAGCGACCTGCAGACGACGATTCTTCTACTCAA-3V, according to the Stratagene Mutagenesis Protocol. To generate a mutant p27 with neutral hydrophobic residues replacing positive residues in the nuclear localization sequence (Flag-p27DNLS; RKR to ALA and KR to LA), four primers were generated and two of them contained specific nucleotide mutations: (a) FYW3: 5V-TCGCGGATCCAATGTCAAACGTGCGAGTGTCT-3V, (b ) FYW4: 5V-GCCGGAATTCTTACGTTTGACGTCTTCTGAG-3V, (c) FYW5: 5V-CCTGCAACCGACGATTCTTCTACTCAAAACCTCGCAGCCACCA GAACAGAAGAAAATGTTTCA-3V, and (d ) FYW6: 5V-GTTTTGAGTAGAAGAATCGTCGGTTGCAGGTGCTAACGCTATTCCTGCGCATTGCTCCGCTAACCC-3V. First, using pcDNA-p27 as template, two different overlapping fragments of p27 genes were obtained by PCR amplifications with primers FYW3 and FYW6, FYW5, and FYW4, respectively. Second, 1 AL of each of the two fragments were pooled together and a second round PCR was conducted with primers FYW3 and FYW4 to generate the full-length p27DNLS cDNA fragment, which was cloned into the pcDNA-Flag vector to generate pcDNA-Flag-p27DNLS. Subsequently, the wild-type and mutant fragments were excised by BamHI/ EcoRI restriction enzyme digestion and cloned into the pBMN-Ires-EGFP retroviral vector (18) to generate pBMN-IRES-EGFP-Flag-p27 plasmids. These were transduced into Phoenix-Ampho packaging cells (19) to generate GFP-encoding retroviruses. To generate retroviruses that express short hairpin RNAs (shRNA) against human p27, two complementary oligonucleotides: 5V-phospho-GATCCCCGCACTGCAGAGACATGGAATTCAAGAGATTCCATGTCTCTGCAGTGCTTTTTGGAAT and 5V-phospho-AGCTATTCCAAAAAGCACTGCAGAGACATGGAATCTCTTGAATTCCATGTCTCTGCAGTGCGGG were annealed and inserted into the BglII/HindIII sites of pSUPER.retro vector (20). The plasmid was transfected into Phoenix-Ampho cells to produce infectious p27-shRNA retroviruses. Virion-containing supernatants were harvested at 48 hours after transfection. As control, oligonucleotides 5V-phosphoGATCCCCGCACTGCCGGGATATGGAATTCAAGAGATTCCATATCCCGGCAGTGCTTTTTGGAAT and 5 V-phospho-AGCTATTCCAAAAAGCACTGCCGGGATATGGAATCTCTTGAATTCCATATCCCGGCAGTGCGGG were annealed and inserted into the same vector, which is specific against mouse p27 gene and, thus, should not interfere with human p27 gene